<<<

=======

<<<

<<<

<<<

<<<

<<<

== < < < < < = = = = = =>>>>>>>>>>>> | | | | | | | | | | | | | | | | | | | | |

=

==

= = = = = = = = = = = = = = = = = = = = == == == == == == == == == ==

> > > > > > > > >

< < < < < < < < < < | | | | | | | | | | ~ ~ ~ ~ ~ ~ ~ ~ ~ ~

~

~~~~~~~~~~~~~~~~~~~~

- - - - - - - - -

-

--

---

---

---

---

---

--->>>>>>>>>>>>>>>>>>>>

@ @ @ @ @ @ @ @ @ @ @ @ @ @ @@ @@ @@ @@ @@ @@ @@ @@ @@ @@ @@ @@ @@

@@@@@@@@@@@@@@@@@@@#

# # # # #

### ######### ######### ######### ######### ######### ######### ######### ######### ######### ### ### ### ### ### ### ### ### ## ## ## ## ## ## ## ##

#

#

#

#

#

#

#

#

#################...

... ... ... ... ...

...

..

.. .. .. .. .. .. .. .. .. .. .. . . . . . . . .

. . .

.

........ ........ ........

.........

......... ......... ====== ====== ====== ====== ====== ====== ====== ====== ====== ====== === === === === === === === === === -------- -------- -------- -------- -------- -------- -------- -------- -------- -------- ++++++++ ++++++++ ++++++++ ++++++++ +++++++++ +++++++ +++++++ +++++++ * * ** ** **

######################################################################################################################################################## $$$$$$$$ $$$$$$$$ $$$$$$$$ $$$$$ $$$ $ $ $ $ $

$ $ $ $

$

$ $ $ $ $ $ %%% %%% %%% %% %% % % % % % % % %

% % % ^^^^^ ^^^^ ^^ ^ ^ ^ ^ ^ ^ ^ & & & & & & &&&& &&&& &&&& &&& && & & & ( ( ( ( ( ( ( ( ((( ((( ((( ((( (( (( ( {{{{{{{{ {{ {{ { { { { { { { {} {} {} {} {} {} {} {} {} {} <> <> <> <> <> <> <> <> |||||| |||| ||| || | |||||||| |||||| |||| || || __ _ __ _ _ _ _ _ _ _ ---- ---- ---- --- -- -- -- -- -- -- -- --- --- --- --- --- --- ---- ---- ---- ---- ---- ---- ---- * ** * * ** * * * * * * * * * * *

---

############################################## $$$ $$$ $$ $$ $

$ $ $ $ $ $ $ $ $ % % % % % % % % ^ ^ ^ ^ ^ ^ ^ & & & & ( ( ( { { { { } <> | | _ _ - - +

= * *

%

^

&

*

_

+

{

}

|

\ / / / / /

\ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ \ / / / / / / / / /

`

{ }

<>

| |

\ /

/

\

\ \ // // //// ////// ////////// /////////////////// /////////////////////////////////// ///////////////////////////////////////////////// ///////////////////////////////////////////////////////////////// ///////////////////////////////////////////////////////////////////////////

///////////////////////////////////////////////////////////////////////////////////

============================================================================================================================== %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% &&&&&&&&&&&&&&&&&&&&&&&&&&&** )))))))))) ]]]]] {{{{{}}}}}

---

------++ ==========**

####----------####################--------------------------========================================--------------------------------------------------------------

.................................................................... 说到::，,"""'''``::::;，;，....... @#{}<>|\/-=_+*&#%$^.,'"/?，:{}|-_+=*&^%$#@!~`....

A娱乐DEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789!@#$%^&_+-={}|\:";'<>，,./~A娱乐DEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789!@#$%^&*_+-={}|\:"; '<>，,./~A娱乐DEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz0123456789!@#$%^&+-={}|\:";'<>，,./~AAAAAAAAAABBBBBBB娱乐CCCCCCCDDDDDDDDEEEEEEEEFFFFFFFFFFGGGGGGGGHHHHHHHHIIIIIIIIJJJJJJKKKKKKLLLLLLLMMMMMMMNNNNNNNOOOOOOOPPPPPPPQQQQQQRRRRRRSSSSSSSTTTTTTTUUUUUUVVVVVVWWWWWWXXXXXXXYYYYYYYZZZZZZZaaaaaaaaabbbbbbbccccccccddddddddeeeeeeeffffffffgggggggghhhhhhhiiiiiiiijjjjjjjkkkkkkklllllllmmmmmmmnnnnnnnooooooopppppppqqqqqqqrrrrrrssssssstttttttuuvvvvvvwwwwwwwxxxxxxxxyyyyyyyzzzzzzz0000000011111111222222223333333444444455555556666667777777888888999999!，!，!，!@@@@######$$$$%%%^^^^^^^^^^^^)----__________========+++++++{{{{}}}}}\\\||||::::;，;"""''',...,///?，'''''""";:::-----______+++{{}}{}\|:;"'<>,.，/~'''""":::----+++{{}}{}\|:;"'<>,.，/~'''""":::----_______+++{{}}{}\|:;"'<>,.，/~.z..z..z..z..z..z..z..z...y.y.y.y.y.y.y.y...x.x.x.x.x.x.x.x...w.w.w.w.w.w.w.w...v.v.v.v.v.v.v.v...u.u.u.u.u.u.u.u...t.t.t.t.t.t.t.t...s.s.s.s.s.s.s.s...r.r.r.r.r.r.r.r...q.q.q.q.q.q.q.q...p.p.p.p.p.p.p.p...o.o.o.o.o.o.o.o...n.n.n.n.n.n.n.n...m.m.m.m.m.m.m.m...l.l.l.l.l.l.l.l...k.k.k.k.k.k.k.k...j.j.j.j.j.j.j.j...i.i.i.i.i.i.i.i...h.h.h.h.h.h.h.h.g.g.g.g.g.g.g.g.f.f.f.f.f.f.f.f.e.e.e.e.e.e.e.d.d.d.d.d.c.c.c.c.b.b.b.a.a.a.Z.Z.Z.Y.Y.Y.X.X.X.W.W.W.V.V.V.U.U.U.T.T.T.S.S.S.R.R.R.Q.Q.Q.P.P.P.O.O.O.N.N.M.M.L.L.K.K.J.J.I.I.H.H.G.G.F.F.E.E.D.C.B.A.z.z.z.z.z.z.z.y.y.y.y.y.y.x.x.x.x.x.w.w.w.w.v.v.v.u.u.u.t.t.t.s.s.s.r.r.r.q.q.q.p.p.p.o.o.n.n.m.m.l.l.k.k.j.j.i.i.h.h.g.g.f.f.e.e.d.d.c.c.b.b.a.a.A.A.B.B.C.C.D.D.E.E.F.F.G.G.H.H.I.I.J.J.K.K.L.L.M.M.N.N.O.O.P.P.Q.Q.R.R.S.S.T.T.U.U.V.V.W.W.X.X.Y.Y.Z.Z.

END END END END END END END END END END END END END END FIN FIN FIN FIN FIN FIN FIN FIN FIN FIN FIN FIN FIN THE THE THE THE THE THE THE THE THE OVER OVER OVER OVER OVER OVER OVER OVER DONE DONE DONE DONE DONE DONE COMPLETE COMPLETE COMPLETE COMPLETE STOP STOP STOP STOP HALT HALT HALT HALT CEASE CEASE CEASE CEASE TERMINATE TERMINATE TERMINATE TERMINATE CLOSE CLOSE CLOSE CLOSE EXIT EXIT EXIT EXIT QUIT QUIT QUIT QUIT BYE BYE BYE GOODBYE GOODBYE ADIOS ADIOS CIAO CIAO SAYONARA SAYONARA AUF WIEDERSEHEN AUF WIEDERSEHEN AU REVOIR AU REVOIR ARRIVEDERCI ARRIVEDERCI DO SVIĐANJA DO SVIĐANJA TOT ZIENS TOT ZIENS FARVEL FARVEL HEJDÅ HEJDÅ NÄCHMAL NÄCHMAL WIEDERSEHEN WIEDERSEHEN TCHAU TCHAU ADEUS ADEUS CHAO CHAO ZÀI JIÀN ZÀI JIÀN SAYŌNARA SAYŌNARA ANNYEONG ANNYEONG SELAMAT JALAN SELAMAT JALAN PAALAM PAALAM PAMPIRI PAMPIRI VIDA VIDA SHALOM SHALOM SALLAM SALLAM KHODA HAFEZ KHODA HAFEZ ALLAH HAFIZ ALLAH HAFIZ MA'ASSALAMA MA'ASSALAMA FI AMANILLAH FI AMANILLAH KEEP SMILING KEEP SMILING TAKE CARE TAKE CARE HE A NICE DAY HE A NICE DAY GOOD LUCK GOOD LUCK BEST WISHES BEST WISHES ALL THE BEST ALL THE BEST MUCH LOVE MUCH LOVE XOXO XOXO HUGS HUGS KISSES KISSES 👋 👋 👋 👋 👋 👋 🤚 🤚 🤚 🤚 🤚 🤚 ✋ ✋ ✋ ✋ ✋ ✋ 🖐️ 🖐️ 🖐️ 🖐️ 🖐️ 🖐️ ☝️ ☝️ ☝️ ☝️ ☝️ ☝️ ✌️ ✌️ ✌️ ✌️ ✌️ ✌️ 🤞 🤞 🤞 🤞 𫠆 𫠆 𫠆 𫠆 𫠆 𫠆 𫠇 𫠇 𫠇 𫠇 𫠇 𫠇 ℹ ℹ ℹ ℹ ℹ ℹ ⓘ ⓘ ⓘ ⓘ ⓘ ⓘ ® ® ® ® ® ® © © © © © © ™ ™ ™ ™ ™ ™ ° ° ° ° ° ° ± ± ± ± ± ± ÷ ÷ ÷ ÷ ÷ ÷ × × × × × × ∞ ∞ ∞ ∞ ∞ ∞ ≠ ≠ ≠ ≠ ≠ ≠ ≤ ≤ ≤ ≤ ≤ ≤ ≥ ≥ ≥ ≥ ≥ ≥ ≈ ≈ ≈ ≈ ≈ ≈ ∂ ∂ ∂ ∂ ∂ ∂ Σ Σ Σ Σ Σ Σ Π Π Π Π Π Π Ω Ω Ω Ω Ω Ω α α α α α α β β β β β β γ γ γ γ γ γ δ δ δ δ δ δ ε ε ε ε ε ε ζ ζ ζ ζ ζ ζ η η η η η η θ θ θ θ θ θ ι ι ι ι ι ι κ κ κ κ κ κ λ λ λ λ λ λ μ μ μ μ μ μ ν ν ν ν ν ν ξ ξ ξ ξ ξ ξ ο ο ο ο ο ο π π π π π π ρ ρ ρ ρ ρ ρ σ σ σ σ σ σ τ τ τ τ τ τ υ υ υ υ υ υ φ φ φ φ φ φ χ χ χ χ χ χ ψ ψ ψ ψ ψ ψ ω ω ω ω ω ω Α Α Α Α Α Α Β Β Β Β Β Β Γ Γ Γ Γ Γ Γ Δ Δ Δ Δ Δ Δ Ε Ε Ε Ε Ε Ε Ζ Ζ Ζ Ζ Ζ Ζ Η Η Η Η Η Η Θ Θ Θ Θ Θ Θ Ι Ι Ι Ι Ι Ι Κ Κ Κ Κ Κ Κ Λ Λ Λ Λ Λ Λ Μ Μ Μ Μ Μ Μ Ν Ν Ν Ν Ν Ν Ξ Ξ Ξ Ξ Ξ Ξ Ο Ο Ο Ο Ο Ο Π Π Π Π Π Π Ρ Ρ Ρ Ρ Ρ Ρ Σ Σ Σ Σ Σ Σ Τ Τ Τ Τ Τ Τ Υ Υ Υ Υ Υ Υ Φ Φ Φ Φ Φ Φ Χ Χ Χ Χ Χ Χ Ψ Ψ Ψ Ψ Ψ Ψ Ω Ω Ω Ω Ω Ω ¡ ¡ ¡ ¡ ¡ ¿ ¿ ¿ ¿ ¿ � � � � � � ■ ■ ■ ■ ■ □ □ □ □ □ ▣ ▣ ▣ ▣ ▣ ▲ ▲ ▲ ▲ ▲ ▼ ▼ ▼ ▼ ▼ ◆ ◆ ◆ ◆ ◆ ◇ ◇ ◇ ◇ ◇ ● ● ● ● ● ○ ○ ○ ○ ○ ◉ ◉ ◉ ◉ ◉ ◎ ◎ ◎ ◎ ◎ ☀ ☀ ☀ ☀ ☀ ★ ★ ★ ★ ★ ☆ ☆ ☆ ☆ ♥ ♥ ♥ ♥ ♥ ♡ ♡ ♡ ♡ ♡ ♦ ♦ ♦ ♦ ♦ ♧ ♧ ♧ ♧♧♧♧♣♣♣♣♣♤♤♤♤♤♡♡♡♡♡♥♥♥♥♥✿✿✿✿✿❀❀❀❀❀☺☺☺☺☺☻☻☻☻☻ツツツツツღღღღღ웃웃웃웃웃유유유유유ΔΔΔΔΔ∇∇∇∇∇△△△△△▽▽▽▽▽◁◁◁◁◁▷▷▷▷▷◇◇◇◇◇◆◆◆◆◆○○○○○●●●●●■■■■■□□□� ▌ ▌ ▌ ▌ ▌ ▐ ▐ ▐ ▐████████████████── ── ── ── ── ━ ━ ━ ━ ━ ─ ─ ─ ─ ─ │ │ │ │ │ ┃ ┃ ┃ ┃ ┃ ┄ ┄ ┄ ┄ ┅ ┅ ┅ ┅┈┈┈┈┈┉┉┉┉┉┊┊┊┊╍╍╍╍╍╎╎╎╎╎╔╔╔╔╔╗╗╗╗╗╚╚╚─────│││││─────├├├├├─────┴┴┴───· · · · · • • • • • ‧ ‧ ‧ ‧ ‧ ⁕ ⁕ ⁕ ⁕ ⁕⁙⁙⁙⁙⁙⋅⋅⋅⋅⋅∶∶∶∶∶≬≬≬≬≬∴∴∴∴∴∵∵∵∵∵ːːːːː˙˙˙˙˙´´´´´¨¨¨¨¨˜˜˜˜˜¯¯¯¯¯°°°°°᾿᾿᾿᾿᾿῀῀῀῀῀‾‾‾‾‾‐‐‐‐‐‑‑‑‑‑––––— — — — ― ― ― ― − − − − ∼ ∼ ∼ ∼ ≈ ≈ ≈ ≃ ≃ ≃ ≅ ≅ ≅ ⩰ ⩰ ⩰ ⩰ ⩰ ⩱ ⩱ ⩱ ⩱ ⩱ ⟂ ⟂ ⟂ ⟂ ⟂ ⟂ ⟶ ⟶ ⟶ ⟶ ⟶ ↭ ↭ ↭ ↭ ↭ ↕ ↕ ↕ ↕ ↑ ↑ ↑ ↑ → → → → ← ← ← ← ↔ ↔ ↔ ↔ ↛ ↛ ↛ ↛ ↚ ↚ ↚ ↚ ↘ ↘ ↘ ↘ ↗ ↗ ↗ ↗ ↘ ↘ ↘ ↘ ↔ ↔ ↔ ↔ ←←←←←→→→→→↑↑↑↑↑↡�̶̶̶̶̶͟͟͟͟͟ƒƒƒƒƒ₲₲₲₲₲฿฿฿฿฿₹₹₹₹₹£££££€€€€€¥¥¥¥¥₩₩₩₩₩⅓⅓⅓⅓⅓½½½½½⅔⅔⅔⅔⅔¼¼¼¼¼⅛⅛⅛⅛⅛①①①①①②②②②②③③③③③④④④④⑤⑤⑤⑤⑥⑥⑥⑥⑦⑦⑦⑦⑧⑧⑧⑧⑨⑨⑨⑨⑩⑩⑩㊱㊱㊱㊱㊱㊲㊲㊲㊲㊲ⅠⅠⅠⅠⅠⅡⅡⅡⅡⅡⅢⅢⅢⅢⅢIVIVIVIVIVVVVVVIIVIIVIIVIIIXIXIXIXXIIXIIXIIXIIIXIIIXIIIXIVXIVXIVXVXVXVXXIIXXIIXXIIIXXIIIXXIVXXIVXXXXLVLVLVLVLXLXLXLXLCLCLCLCLDCDCDCDMMMMMMØØØØØÅÅÅÅÅÃÃÃÃÃÄÄÄÄÄÖÖÖÖÖÜÜÜÜÜßßßßßÇÇÇÇÇÑÑÑÑÑÁÁÁÁÁÉÉÉÉÉÍÍÍÍÍÓÓÓÓÓÚÚÚÚÚàààààèèèèèìììììòòòòòùùùùùâââââêêêêêîîîîîôôôôôûûûûûãããããõõõõõäääääëëëëëïïïïïöööööüüüüüyÿyÿyðððððþþþþþœœœœœšššššžžžžžŸŸŸŸŸªªªªªººººº¿¿¿¿¿¡¡¡¡¡§§§§§†††††‡‡‡‡‡•••••…，…，…‹‹‹‹‹›››› ›℗℗℗℗℗™™™™™℠℠℠℠℮℮℮№№№№№℃℃℃℃℃℉℉ΩΩΩΩΩµµµµµÅÅÅÅÅʹʹʹʹʹ΅΅΅΅΅ϰϰϰϰϰϱϱϱϱϱϲϲϲϲϳφφφφχχχψψψωωωϊϊϊΐΐΐύύύαααβββγγγδεεεζζζηηηθθθιιικκκλλλμμμνννξξξοοοπππρρρσςςςτττυυυφφφχχχψψψωωωϊϊϊΐΐΐόόόύύύώώώΑΑΑΒΒΒΓΓΓΔΔΔΕΕΕΖΖΖΗΗΗΘΘΙΙΙΚΚΚΛΛΛΜΜΜΝΝΝΞΞΟΟΟΠΠΠΡΣΣΤΤΥΦΧΧΧΧΧΧΧΧΧΧΧ.Χ.Χ.Χ.Χ.Χ.Χ.Χ.Χ.Χ.Χ.Χ.Χ那些那些那些那些那些那些那些那些那些那些那些那些那些那些那些那些那些那些那些那些那个那个那个那个那个那个那那那那那纳纳纳纳纳哪哪哪哪哪呢呢呢呢呢呐呐呐呐呐拿拿拿拿拿挪挪挪挪挪哦哦哦哦哦噢噢噢噢噢额额额额额欸欸欸欸欸诶诶诶诶诶唉唉唉唉唉哎哎哎哎哎啼啼啼啼啼呀呀呀呀呀呀啊啊啊啊啊阿阿阿阿阿吖吖吖吖吖呵呵呵呵呵呵呵哈哈哈哈哈嘿嘿嘿嘿嗨嗨嗨嗨哼哼哼哼嗯嗯嗯嗯唔唔唔唔恩恩恩恩哦噢呃呃呃呃呃哎呀哎呀哎呀哎呀哎呀哎呀咦咦咦咦咦yoyoyoyoyoyayayayayawoiwowowowooiieeeeeaahhoohheeyyahahahaheheheihihihihohohohumumumumuhuhuhuhahahahawowowowoheyheyheyyoyoyozozozozozozoomzoomzoomzoomboomboomboomboomcrashcrashcrashbangbangbangpoppoppopclickclickclicksnapsnapsnapclapclapclapstompstompstomptaptaptapknockknockknockringringringdingdingdongdongdongbuzzbuzzbuzzhumhumhumwhirwhirwhirswishswishswishwhooshwhooshwhooshswooshswooshswooshshhhshhhshhhpsstpsstpssshushushuswhisperwhisperwhispermurmurmurmurrumble rumble rumble grumble grumble grumble growl growl growl roar roar roar bark bark bark meow meow meow purr purr purr hiss hiss hiss chirch chirch chirch tweet tweet tweet caw caw caw quack quack quack moo moo moo baa baa baa neigh neigh neigh oink oink oink ribbit ribbit ribbit croak croak croak buzz buzz buzz zzz zzz zzz snore snore snore cough cough cough sneeze sneeze sneeze sniff sniff sniff sigh sigh sigh yawn yawn yawn burburburphphphachooachooachoogasp gaspgasp gulp gulp gulp swallow swallow swallow chew chew chew crunch crunch crunch munch munch munch slurp slurp slurp sip sip sip gulp gulp gulp ah ah ah mmm mmm mmm yum yum yum nom nom nom delicious delicious delicious tasty tasty tasty yummy yummy yummy wow wow wow amazing amazing amazing awesome awesome awesome great great great good good good nice nice nice cool cool cool sweet sweet sweet lit lit lit fire fire fire bomb bomb bomb goat goat goat flex flex flex stan stan stan mood mood mood vibes vibes vibes energy energy energy aura aura aura flow flow flow zone zone zone grind grind grind hustle hustle hustle rise rise rise shine shine shine glow glow glow sparkle sparkle sparkle magic magic magic dream dream dream believe believe believe achieve achieve achieve succeed succeed succeed win win win champion champion champion legend legend legend icon icon icon star star star hero hero hero boss boss boss king king king queen queen queen god god god tier tier tier op op op broken broken broken meta meta meta gg gg gg ez ez ez wp wp wp gl gl gl hf hf hf ty ty ty np np np yw yw yw k k k ok ok ok sure sure sure yes yes yes yeah yeah yeah yep yep yep yea yea yea ya ya ya nah nah nah nope nope nope no no no never never never nothing nothing nothing none none none zero zero zero void void void null null null empty empty empty blank blank blank missing missing missing absent absent absent gone gone gone lost lost lost forgotten forgotten forgotten erased erased erased deleted deleted deleted removed removed removed cleared cleared cleaned cleaned wiped wiped wiped reset reset restart restart reboot reboot refresh refresh renew renew revive revive restore restore recover recover heal heal heal fix fix fix repair repair repair mend mend mend patch patch patch solve solve solve resolve resolve resolve answer answer answer key key key solution solution solution way way way path path path road road road map map map guide guide guide compass compass compass north north north south south south east east east west west west up up up down down down left left left right right right forward forward forward backward backward backward backward backward backward back back back return return return come come come go go go stay stay stay wait wait wait stop stop stop halt halt halt pause pause pause break break break rest rest rest sleep sleep sleep wake wake wake rise rise rise stand stand stand walk walk walk run run run fly fly fly swim swim swim dive dive dive jump jump jump leap leap leap hop hop hop skip skip skip dance dance dance sing sing sing play play play laugh laugh laugh smile smile smile grin grin grin wink wink wink blink blink blink stare stare stare glare glare glare peek peek peek spy spy spy watch watch watch observe observe observe see see see look look look view view view sight sight sight vision vision vision eye eye eye mind mind mind brain brain brain think think think know know know understand understand understand realize realize realize learn learn learn remember remember remember forget forget forget memory memory memory thought thought thought idea idea idea concept concept concept ory ory ory fact fact fact truth truth truth reality reality reality world world world universe universe universe space space space time time time past past past present present present future future future now now now here here here re re re everywhere everywhere everywhere nowhere nowhere nowhere somewhere somewhere somewhere anywhere anywhere anywhere place place place location location location spot spot spot point point point position position position coordinate coordinate coordinate GPS GPS GPS latitude latitude latitude longitude longitude longitude altitude altitude altitude height height height depth depth deep deep shallow shallow shallow surface surface surface ground ground ground floor floor floor ceiling ceiling ceiling roof roof roof sky sky sky cloud cloud cloud sun sun sun moon moon moon star star star planet planet planet galaxy galaxy galaxy cosmos cosmos cosmos infinity infinity infinity eternal eternal eternal forever forever forever always always always never never never sometimes sometimes sometimes often often often usually usually usually rarely rarely rarely seldom seldom seldom once once once twice twice twice thrice thrice thrice many many many few few few several several several some some some any any any all all all every each each each both both both eir eir eir neir neir neir one one one two two two three three three four four four five five five six six six seven seven seven eight eight eight nine nine nine ten ten ten hundred hundred hundred thousand thousand thousand million million million billion billion billion trillion trillion trillion googol googol googol infinite infinite infinite endless endless endless boundless boundless boundless limitless limitless limitless measureless measureless measureless countless countless countless innumerable innumerable innumerable myriad myriad myriad plethora plethora plethora abundance abundance abundance plenty plenty plenty lots lots lots much much much more more more most most most maximum maximum maximum peak peak peak top top top summit summit summit zenith zenith zenith apex apex apex climax climax climax height height height high high high higher higher higher highest highest highest low low low lower lower lower lowest lowest lowest bottom bottom bottom base base base foundation foundation foundation root root root core core core heart heart heart center center center middle middle middle midpoint midpoint midpoint average average average mean mean mean median median median mode mode mode normal normal normal typical typical typical common common common usual usual usual ordinary ordinary ordinary regular regular regular standard standard standard default default default basic basic basic simple simple simple easy easy easy trivial trivial trivial minor minor minor slight slight slight small small small tiny tiny tiny mini mini mini micro micro micro nano nano nano pico pico pico femto femto femto atto atto atto zepto zepto zepto yocto yocto yocto huge huge huge giant giant giant massive massive massive enormous enormous enormous colossal colossal colossal gigantic gigantic gigantic immense immense immense vast vast vast tremendous tremendous tremendous monstrous monstrous monstrous mammoth mammoth mammoth titanic titanic titanic cosmic cosmic cosmic universal universal universal global global global planetary planetary planetary worldwide worldwide worldwide international international international national national national local local local regional regional regional domestic domestic domestic internal internal internal external external external foreign foreign foreign alien alien alien strange strange strange weird weird weird odd odd odd bizarre bizarre bizarre peculiar peculiar peculiar unique unique unique special special special distinct distinct distinct different different different separate separate separate individual individual individual single single single solo solo solo alone alone alone lonely lonely lonely isolated isolated isolated remote remote remote far far far distant distant distant near near near close close close adjacent adjacent adjacent next next next beside beside beside nearby nearby nearby neighbor neighbor neighbor neighborhood neighborhood neighborhood community community community society society society civilization civilization civilization culture culture culture tradition tradition tradition custom custom custom habit habit habit ritual ritual ritual routine routine routine practice practice practice norm norm norm rule rule rule law law law regulation regulation regulation policy policy policy code code code principle principle principle value value value belief belief belief faith faith faith trust trust trust confidence confidence confidence hope hope hope optimism optimism optimism positive positive positive bright bright bright light light light shine shine shine illuminate illuminate illuminate radiate radiate radiate glow glow glow beam beam beam ray ray ray photon photon photon wave wave wave particle particle particle quantum quantum quantum physics physics physics science science science math math math logic logic logic reason reason reason rational rational rational smart smart smart intelligent intelligent intelligent wise wise wise genius genius genius brilliant brilliant brilliant clever clever clever sharp sharp sharp bright bright bright gifted gifted gifted talented talented talented skilled skilled skilled expert expert expert master master master pro pro pro veteran veteran veteran elite elite elite top top top best best best greatest greatest greatest supreme supreme supreme ultimate ultimate ultimate final final final last last last end end end finish finish finish complete complete complete done done done over over over through through through past past past beyond beyond beyond above above above below below below under under under beneath beneath beneath underneath underneath underneath inside inside inside outside outside outside within within within throughout throughout throughout across across across 娱乐ween 娱乐ween 娱乐ween among among among amid amid amid midst midst midst center center center core core core heart heart heart soul soul soul spirit spirit spirit essence essence essence being being being entity entity entity existence existence existence life life life alive alive alive live live live exist exist exist brea brea brea beat beat beat pulse pulse pulse rhythm rhythm rhythm tempo tempo tempo pace pace pace speed speed speed fast fast fast quick quick quick rapid rapid rapid swift swift swift instant instant instant immediate immediate immediate sudden sudden sudden abrupt abrupt abrupt sharp sharp sharp steep steep steep vertical vertical vertical horizontal horizontal horizontal diagonal diagonal diagonal slope slope slope angle angle angle corner corner corner edge edge edge border border border boundary boundary boundary limit limit limit line line line curve curve curve arc arc arc circle circle circle sphere sphere sphere ball ball ball round round round oval oval oval elliptical elliptical elliptical spiral spiral spiral helix helix helix coil coil coil spring spring spring bounce bounce bounce oscillate oscillate oscillate vibrate vibrate vibrate shake shake shake tremble tremble tremble quake quake quake earthquake earthquake earthquake seismic seismic seismic tectonic tectonic tectonic plate plate plate fault fault fault split split split divide divide divide separate separate separate part part part piece piece piece fragment fragment fragment bit bit bit chunk chunk chunk block block block section section section segment segment segment portion portion portion slice slice slice cut cut cut carve carve carve shape shape shape form form form mold mold mold cast cast cast build build build construct construct construct create create create make make make produce produce produce generate generate generate spawn spawn spawn birth birth birth born born born arise arise arise emerge emerge emerge appear appear appear manifest manifest manifest materialize materialize materialize realize realize realize actualize actualize actualize fulfill fulfill fulfill achieve achieve achieve accomplish accomplish accomplish complete complete complete finish finish finish conclude conclude conclude terminate terminate terminate end end end close close close shut shut shut lock lock lock seal seal seal secure secure secure safe safe safe protect protect protect guard guard guard defend defend defend shield shield shield shelter shelter shelter cover cover cover hide hide hide conceal conceal conceal mask mask mask disguise disguise disguise camouflage camouflage camouflage stealth stealth stealth invisible invisible invisible unseen unseen unseen hidden hidden hidden secret secret secret mystery mystery mystery enigma enigma enigma puzzle puzzle puzzle riddle riddle riddle question question question query query query ask ask ask inquire inquire inquire wonder wonder wonder ponder ponder ponder think think think consider consider consider contemplate contemplate contemplate reflect reflect reflect meditate meditate meditate philosophize philosophize philosophize speculate speculate speculate hyposize hyposize hyposize orize orize orize postulate postulate postulate assume assume assume presume presume presume suppose suppose suppose guess guess guess estimate estimate estimate approximate approximate approximate calculate calculate calculate compute compute compute process process process execute execute execute run run run operate operate operate function function function work work work perform perform perform act act act do do do make make make happen happen happen cause cause cause effect effect effect result result result outcome outcome outcome consequence consequence consequence impact impact impact influence influence influence affect affect affect change change change transform transform transform modify modify modify alter alter alter adjust adjust adjust adapt adapt adapt evolve evolve evolve mutate mutate mutate vary vary vary shift shift shift switch switch switch swap swap swap exchange exchange exchange trade trade trade barter barter barter deal deal deal bargain bargain bargain negotiate negotiate negotiate agree agree agree consent consent consent accept accept accept approve approve approve authorize authorize authorize permit permit permit allow allow allow enable enable enable empower empower empower grant grant grant give give give offer offer offer provide provide provide supply supply supply deliver deliver deliver send send send transmit transmit transmit convey convey convey transfer transfer transfer move move move transport transport transport carry carry carry bear bear bear hold hold hold keep keep keep retain retain retain maintain maintain maintain sustain sustain sustain support support support uphold uphold uphold back back back reinforce reinforce reinforce strengn strengn strengn fortify fortify fortify boost boost boost enhance enhance enhance improve improve improve upgrade upgrade upgrade refine refine refine polish polish polish perfect perfect perfect optimize optimize optimize maximize maximize maximize amplify amplify amplify intensify intensify intensify escalate escalate escalate increase increase increase grow grow grow expand expand expand extend extend extend stretch stretch stretch lengn lengn lengn widen widen widen broaden broaden broaden enlarge enlarge enlarge scale scale scale multiply multiply multiply compound compound compound accumulate accumulate accumulate gar gar gar collect collect collect amass amass amass hoard hoard hoard stack stack stack pile pile pile heap heap heap mound mound mound mountain mountain mountain hill hill hill valley valley valley plain plain plain field field field land land land earth earth earth soil soil soil dirt dirt dirt dust dust dust sand sand sand rock rock rock stone stone stone pebble pebble pebble gravel gravel gravel mineral mineral mineral crystal crystal crystal gem gem gem diamond diamond diamond gold gold gold silver silver silver metal metal metal iron iron iron steel steel steel copper copper copper bronze bronze bronze alloy alloy alloy element element element atom atom atom molecule molecule molecule compound compound compound substance substance substance matter matter matter mass mass mass weight weight weight density density density volume volume volume space space space dimension dimension dimension size size size scale scale scale magnitude magnitude magnitude order order order degree degree degree level level level grade grade grade rank rank rank class class class category category category type type type kind kind kind sort sort sort variety variety variety species species species genus genus genus family family family order order order phylum phylum phylum kingdom kingdom kingdom domain domain domain life life life organism organism organism creature creature creature beast beast beast animal animal animal plant plant plant flora flora flora fauna fauna fauna nature nature nature wild wild wild free free free roam roam roam wander wander wander explore explore explore discover discover discover find find find locate locate locate search search search seek seek seek hunt hunt hunt track track track trace trace trail trail trail follow follow follow pursue pursue pursue chase chase chase catch catch catch capture capture capture seize seize seize grab grab grab grasp grasp grasp clutch clutch clutch grip grip grip hold hold hold clench clench clench squeeze squeeze squeeze press press press push push push pull pull pull drag drag drag lift lift lift raise raise raise elevate elevate elevate ascend ascend ascend climb climb climb mount mount mount scale scale scale conquer conquer conquer overcome overcome overcome surmount surmount surmount transcend transcend transcend surpass surpass surpass exceed exceed exceed outdo outdo outdo outshine outshine outshine excel excel excel dominate dominate dominate prevail prevail prevail triumph triumph triumph victory victory victory win win win succeed succeed succeed achieve achieve achieve attain attain attain reach reach reach arrive arrive arrive get get get obtain obtain obtain acquire acquire acquire gain gain gain earn earn earn win win win score score score point point point mark mark mark grade grade grade rate rate rate rank rank rank position position position standing standing standing status status status state state state condition condition condition situation situation situation circumstance circumstance circumstance context context context environment environment environment setting setting setting scene scene scene stage stage stage platform platform platform arena arena arena field field field ground ground ground court court court ring ring ring mat mat mat floor floor floor turf turf turf grass grass grass green green green lawn lawn lawn yard yard yard garden garden garden park park park forest forest forest wood wood wood tree tree tree leaf leaf leaf branch branch branch trunk trunk trunk root root root bark bark bark wood wood wood timber timber timber lumber lumber lumber log log log board board board plank plank plank sheet sheet sheet panel panel panel slab slab slab brick brick brick stone stone stone concrete concrete concrete cement cement cement mortar mortar mortar building building building structure structure structure architecture architecture architecture construction construction construction edifice edifice edifice tower tower tower skyscraper skyscraper skyscraper high-rise high-rise high-rise apartment apartment apartment condo condo condo flat flat flat unit unit unit room room room chamber chamber chamber hall hall hall corridor corridor corridor passage passage passage hallway hallway hallway lobby lobby lobby entrance entrance entrance exit exit exit door door door gate gate gate portal portal portal window window window glass glass glass pane pane pane frame frame frame sill sill sill ledge ledge ledge balcony balcony balcony terrace terrace terrace patio patio patio deck deck deck porch porch porch veranda veranda veranda roof roof roof ceiling ceiling ceiling attic attic attic basement basement basement cellar cellar cellar foundation foundation foundation ground ground ground floor floor floor level level level story story story storey storey storey penthouse penthouse penthouse suite suite suite loft loft loft studio studio studio garage garage garage shed shed shed barn barn barn warehouse warehouse warehouse factory factory factory plant plant plant mill mill mill workshop workshop workshop lab lab lab laboratory laboratory laboratory facility facility facility complex complex complex campus campus campus site site site property property property real estate real estate real estate lot lot lot parcel parcel parcel plot plot plot acre acre acre hectare hectare hectare zone zone zone district district district sector sector sector block block block neighborhood neighborhood neighborhood community community community village village village town town town city city city metropolis metropolis metropolis capital capital capital downtown downtown downtown uptown uptown uptown midtown midtown midtown suburb suburb suburb rural rural rural urban urban urban municipal municipal municipal civic civic civic public public public private private private residential residential residential commercial commercial commercial industrial industrial industrial agricultural agricultural agricultural zones zones zones land use land use land use planning planning planning development development development growth growth growth expansion expansion expansion sprawl sprawl sprawl density density density population population population people people people citizen citizen citizen resident resident resident inhabitant inhabitant inhabitant dweller dweller dweller occupant occupant occupant tenant tenant tenant owner owner owner landlord landlord landlord homeowner homeowner homeowner householder householder householder family family family household household household clan clan clan tribe tribe tribe group group group team team team crew crew crew squad squad squad unit unit unit force force force army army army troop troop troop soldier soldier soldier warrior warrior warrior fighter fighter fighter hero hero hero champion champion champion victor victor victor winner winner winner conqueror conqueror conqueror king king king queen queen queen ruler ruler ruler monarch monarch monarch emperor emperor emperor sovereign sovereign sovereign lord lord lord master master master chief chief chief head head head leader leader leader boss boss boss manager manager manager director director director executive executive executive officer officer officer official official official authority authority authority power power power control control control command command command rule rule rule govern govern govern reign reign reign dominate dominate dominate suppress suppress suppress oppress oppress oppress tyranny tyranny tyranny dictatorship dictatorship dictatorship autocracy autocracy autocracy totalitarian totalitarian totalitarian authoritarian authoritarian authoritarian fascism fascism fascism nazism nazism nazism communism communism communism socialism socialism socialism democracy democracy democracy republic republic republic federation federation federation union union union alliance alliance alliance coalition coalition coalition partnership partnership partnership treaty treaty treaty pact pact pact accord accord accord agreement agreement agreement contract contract contract deal deal deal arrangement arrangement arrangement understanding understanding understanding consensus consensus consensus harmony harmony harmony peace peace peace truce truce truce ceasefire ceasefire ceasefire armistice armistice armistice treaty treaty treaty settlement settlement settlement resolution resolution resolution compromise compromise compromise negotiation negotiation negotiation diplomacy diplomacy diplomacy politics politics politics government government government state state state nation nation nation country country country territory territory territory border border border frontier frontier frontier boundary boundary boundary line line line divide divide divide partition partition partition split split split separation separation separation segregation segregation segregation isolation isolation isolation quarantine quarantine quarantine lockdown lockdown lockdown restrict restrict restrict confine confine confine imprison imprison imprison jail jail jail prison prison prison cell cell cell cage cage cage trap trap trap net net net web web web snare snare snare hook hook hook bait bait bait lure lure lure tempt tempt tempt entice entice entice attract attract attract draw draw draw pull pull pull magnet magnet magnet gravity gravity gravity force force force energy energy energy power power power strength strength strength might might might vigor vigor vigor vitality vitality vitality stamina stamina stamina endurance endurance endurance resistance resistance resistance immunity immunity immunity defense defense defense protection protection protection shield shield shield armor armor armor guard guard guard ward ward ward barrier barrier barrier wall wall wall fence fence fence hedge hedge hedge moat moat moat ditch ditch ditch trench trench trench bunker bunker bunker shelter shelter shelter fortress fortress fortress castle castle castle citadel citadel citadel stronghold stronghold stronghold keep keep keep palace palace palace mansion mansion mansion manor manor manor estate estate estate villa villa villa chalet chalet chalet cottage cottage cottage cabin cabin cabin hut hut hut s s s tent tent tent camp camp camp base base base camp camp camp station station station post post post outpost outpost outpost fort fort fort garrison garrison garrison barracks barracks barracks headquarters headquarters headquarters command command command center center center hub hub hub node node node nexus nexus nexus junction junction junction intersection intersection intersection crossing crossing crossing bridge bridge bridge tunnel tunnel tunnel passage passage passage path path path way way way route route route road road road street street street avenue avenue avenue boulevard boulevard boulevard lane lane lane alley alley alley drive drive drive court court court place place place square square square plaza plaza plaza circle circle circle roundabout roundabout roundabout highway highway highway freeway freeway freeway expressway expressway expressway interstate interstate interstate motorway motorway motorway autobahn autobahn autobahn turnpike turnpike turnpike toll toll toll fare fare fare ticket ticket ticket pass pass pass visa visa visa permit permit permit license license license ID ID ID card card card document document document paper paper paper record record record file file file data data data info info info knowledge knowledge knowledge wisdom wisdom wisdom insight insight insight understanding understanding understanding comprehension comprehension comprehension grasp grasp grasp mastery mastery mastery expertise expertise expertise skill skill skill ability ability ability talent talent talent gift gift gift knack knack knack flair flair flair aptitude aptitude aptitude capacity capacity capacity potential potential potential promise promise promise prospect prospect prospect future future future destiny destiny destiny fate fate fate luck luck luck fortune fortune fortune chance chance chance opportunity opportunity possibility possibility probability probability probability odds odds odds risk risk risk gamble gamble gamble 娱乐 娱乐 娱乐 wager wager wager stake stake stake investment investment investment venture venture venture speculation speculation speculation gamble gamble gamble lottery lottery lottery raffle raffle raffle prize prize prize reward reward reward award award award trophy trophy trophy medal medal medal badge badge badge honor honor honor glory glory glory fame fame fame renown renown renown reputation reputation reputation prestige prestige prestige status status status standing standing standing rank rank rank title title title name name name label label label tag tag tag brand brand brand trademark trademark trademark logo logo logo mark mark mark sign sign sign symbol symbol symbol icon icon icon emblem emblem emblem crest crest crest coat coat coat arms arms arms flag flag flag banner banner banner standard standard standard ensign ensign ensign pennant pennant pennant streamer streamer streamer colors colors colours colours colours uniform uniform uniform dress dress dress costume costume costume outfit outfit outfit attire attire attire garment garment garment clothing clothing clothing apparel apparel apparel wear wear wear fashion fashion fashion style style style trend trend trend vogue vogue vogue mode mode mode look look look appearance appearance appearance image image image picture picture picture photo photo photo photograph photograph photograph snapshot snapshot snapshot shot shot shot pic pic pic selfie selfie selfie portrait portrait portrait landscape landscape landscape scenery scenery scenery view view view vista vista vista panorama panorama panorama horizon horizon horizon skyline skyline skyline silhouette silhouette silhouette outline outline outline contour contour contour profile profile profile shape shape shape form form form figure figure figure body body body physique physique physique build build build frame frame frame anatomy anatomy anatomy structure structure structure skeleton skeleton skeleton bone bone bone joint joint joint muscle muscle muscle tendon tendon tendon ligament ligament ligament tissue tissue tissue organ organ organ system system system biology biology biology anatomy anatomy anatomy physiology physiology physiology medicine medicine medicine health health health wellness wellness wellness fitness fitness fitness exercise exercise exercise workout workout workout training training training sport sport sport game game game play play play match match match competition competition competition tournament tournament tournament league league league championship championship championship cup cup cup title title title crown crown crown throne throne throne scepter scepter scepter orb orb orb jewel jewel jewel gem gem gem treasure treasure treasure wealth wealth wealth riches riches riches gold gold gold money money money cash cash cash currency currency currency coin coin coin bill bill bill note note note check check check credit credit credit debit debit debit account account account bank bank bank vault vault vault safe safe safe deposit deposit deposit withdraw withdraw withdraw transfer transfer transfer pay pay pay spend spend spend buy buy buy purchase purchase purchase acquire acquire acquire obtain obtain obtain get get get receive receive receive accept accept accept take take take grab grab grab seize seize seize claim claim claim demand demand demand require require require need need need want want want desire desire desire wish wish wish hope hope hope dream dream dream aspire aspire aspire aim aim aim target target target goal goal goal objective objective objective purpose purpose purpose mission mission mission vision vision vision plan plan plan strategy strategy strategy tactic tactic tactic approach approach approach method method method technique technique technique skill skill skill art art art craft craft craft trade trade trade profession profession profession career career career job job job work work work labor labor labor toil toil toil effort effort effort exertion exertion exertion strain strain strain stress stress stress pressure pressure pressure burden burden burden load load load weight weight weight responsibility responsibility responsibility duty duty duty obligation obligation obligation task task task chore chore chore assignment assignment assignment project project project endeavor endeavor endeavor undertaking undertaking undertaking enterprise enterprise enterprise venture venture venture business business business company company company firm firm firm corporation corporation corporation inc inc inc LLC LLC LLC Ltd Ltd Ltd PLC PLC PLC Group Group Group Holding Holding Holding Trust Trust Trust Fund Fund Fund Capital Capital Capital Partners Partners Partners Associates Associates Associates Ventures Ventures Ventures Investments Investments Investments Management Management Management Consulting Consulting Consulting Services Services Services Solutions Solutions Solutions Systems Systems Systems Technologies Technologies Technologies Innovations Innovations Innovations Labs Labs Labs Research Research Research Development Development Development R&D R&D R&D Engineering Engineering Engineering Design Design Design Architecture Architecture Architecture Construction Construction Construction Building Building Building Infrastructure Infrastructure Infrastructure Transport Transport Transport Logistics Logistics Logistics Supply Supply Supply Chain Chain Chain Network Network Network Grid Grid Grid Web Web Web Net Net Net Matrix Matrix Matrix Framework Framework Framework Structure Structure Structure Model Model Model Pattern Pattern Pattern Template Template Template Blueprint Blueprint Blueprint Plan Plan Plan Scheme Scheme Scheme Design Design Design Layout Layout Layout Format Format Format Standard Standard Standard Protocol Protocol Protocol Specification Specification Specification Requirement Requirement Requirement Criteria Criteria Criteria Metric Metric Metric Measure Measure Measure Gauge Gauge Gauge Indicator Indicator Indicator Signal Signal Signal Flag Flag Flag Mark Mark Mark Token Token Token Symbol Symbol Symbol Sign Sign Sign Badge Badge Badge Emblem Emblem Emblem Crest Crest Crest Shield Shield Shield Coat Coat Coat Arms Arms Arms Heraldry Heraldry Heraldry Blazon Blazon Blazon Charge Charge Charge Field Field Field Tincture Tincture Tincture Metal Metal Metal Color Color Color Fur Fur Fur Ordinary Ordinary Ordinary Division Division Division Partition Partition Partition Line Line Line Bend Bend Bend Chevron Chevron Chevron Pale Pale Pale Fess Fess Fess Cross Cross Cross Saltire Saltire Saltire Chief Chief Chief Bordure Bordure Bordure Canton Canton Canton Quarter Quarter Quarter Flanch Flanch Flanch Gyron Gyron Gyron Label Label Label Difference Difference Difference Cadency Cadency Cadency Brisure Brisure Brisure Mark Mark Mark Distinction Distinction Distinction Identity Identity Identity Recognition Recognition Recognition Auntication Auntication Auntication Verification Verification Verification Validation Validation Validation Confirmation Confirmation Confirmation Proof Proof Proof Evidence Evidence Evidence Testimony Testimony Testimony Witness Witness Witness Affidavit Affidavit Affidavit Deposition Deposition Deposition Statement Statement Statement Declaration Declaration Declaration Oath Oath Oath Vow Vow Vow Pledge Pledge Pledge Promise Promise Promise Commitment Commitment Commitment Bond Bond Bond Contract Contract Contract Covenant Covenant Covenant Agreement Agreement Agreement Pact Pact Pact Accord Accord Accord Treaty Treaty Treaty Alliance Alliance Alliance Union Union Union Federation Federation Federation Confederation Confederation Confederation League League League Coalition Coalition Coalition Bloc Bloc Bloc Axis Axis Axis Partnership Partnership Partnership Coalition Coalition Coalition Front Front Front Movement Movement Movement Campaign Campaign Campaign Crusade Crusade Crusade Cause Cause Cause Mission Mission Mission Purpose Purpose Purpose Goal Goal Goal Aim Aim Aim Target Target Target Objective Objective Objective End End End Result Result Result Outcome Outcome Outcome Effect Effect Effect Consequence Consequence Consequence Impact Impact Impact Influence Influence Influence Change Change Change Transformation Transformation Transformation Revolution Revolution Revolution Evolution Evolution Evolution Progress Progress Progress Development Development Development Growth Growth Growth Advance Advance Advance Improvement Improvement Improvement Enhancement Enhancement Enhancement Upgrade Upgrade Upgrade Update Update Update Patch Patch Patch Fix Fix Fix Repair Repair Repair Correction Correction Correction Amendment Amendment Amendment Revision Revision Revision Modification Modification Modification Adjustment Adjustment Adjustment Adaptation Adaptation Adaptation Customization Customization Customization Personalization Personalization Personalization Configuration Configuration Configuration Setup Setup Setup Installation Installation Installation Deployment Deployment Deployment Implementation Implementation Implementation Integration Integration Integration Migration Migration Migration Transition Transition Transition Conversion Conversion Conversion Transfer Transfer Transfer Port Port Port Adapt Adapt Adapt Adopt Adopt Adopt Embrace Embrace Embrace Accept Accept Accept Welcome Welcome Welcome Greet Greet Greet Meet Meet Meet Encounter Encounter Encounter Face Face Face Confront Confront Confront Challenge Challenge Challenge Oppose Oppose Oppose Resist Resist Resist Defy Defy Defy Rebel Rebel Rebel Revolt Revolt Revolt Mutiny Mutiny Mutiny Uprising Uprising Uprising Insurrection Insurrection Insurrection Revolution Revolution Revolution Coup Coup Coup Overthrow Overthrow Overthrow Topple Topple Topple Depose Depose Depose Remove Remove Remove Oust Oust Oust Expel Expel Expel Banish Banish Banish Exile Exile Exile Deport Deport Deport Repatriate Repatriate Repatriate Return Return Return Restore Restore Restore Reinstate Reinstate Reinstate Reestablish Reestablish Reestablish Revive Revive Revive Renew Renew Renew Refresh Refresh Refresh Regenerate Regenerate Regenerate Restore Restore Restore Heal Heal Heal Cure Cure Cure Treat Treat Treat Mend Mend Mend Fix Fix Fix Repair Repair Repair Restore Restore Restore Recover Recover Recover Recuperate Recuperate Recuperate Rehabilitation Rehabilitation Rehabilitation Therapy Therapy Therapy Treatment Treatment Treatment Care Care Care Nursing Nursing Nursing Medicine Medicine Medicine Drug Drug Drug Pill Pill Pill Tablet Tablet Tablet Capsule Capsule Capsule Injection Injection Injection Shot Shot Shot Vaccine Vaccine Vaccine Immunization Immunization Immunization Inoculation Inoculation Inoculation Booster Booster Booster Dose Dose Dose Prescription Prescription Prescription Medication Medication Medication Pharmaceutical Pharmaceutical Pharmaceutical Remedy Remedy Remedy Cure Cure Cure Healing Healing Healing Recovery Recovery Recovery Wellness Wellness Wellness Health Health Health Vitality Vitality Vitality Fitness Fitness Fitness Strength Strength Strength Power Power Power Energy Energy Energy Stamina Stamina Stamina Endurance Endurance Endurance Performance Performance Performance Athletic Athletic Athletic Sport Sport Sport Exercise Exercise Exercise Workout Workout Workout Training Training Training Practice Practice Practice Drill Drill Drill Routine Routine Routine Regimen Regimen Regimen Program Program Program Schedule Schedule Schedule Plan Plan Plan Calendar Calendar Calendar Agenda Agenda Agenda Timetable Timetable Timetable Itinerary Itinerary Itinerary Route Route Route Path Path Path Way Way Way Course Course Course Track Track Track Trail Trail Trail Road Road Road Journey Journey Journey Trip Trip Trip Voyage Voyage Voyage Expedition Expedition Expedition Adventure Adventure Adventure Quest Quest Quest Mission Mission Mission Odyssey Odyssey Odyssey Pilgrimage Pilgrimage Pilgrimage Trek Trek Trek Hike Hike Hike Walk Walk Walk Stroll Stroll Stroll Wander Wander Wander Roam Roam Roam Explore Explore Explore Discover Discover Discover Find Find Find Uncover Uncover Uncover Reveal Reveal Reveal Expose Expose Expose Detect Detect Detect Sense Sense Sense Perceive Perceive Perceive Observe Observe Observe Notice Notice Notice Spot Spot Spot Identify Identify Identify Recognize Recognize Recognize Diagnose Diagnose Diagnose Analyze Analyze Analyze Examine Examine Examine Inspect Inspect Inspect Scan Scan Scan Screen Screen Screen Test Test Test Check Check Check Verify Verify Verify Validate Validate Validate Confirm Confirm Confirm Aunticate Aunticate Aunticate Approve Approve Approve Certify Certify Certify Accredit Accredit Accredit License License License Authorize Authorize Authorize Permit Permit Permit Allow Allow Allow Enable Enable Enable Empower Empower Empower Grant Grant Grant Delegate Delegate Delegate Assign Assign Assign Appoint Appoint Appoint Designate Designate Designate Nominate Nominate Nomin Elect Elect Elect Choose Choose Choose Select Select Select Pick Pick Pick Decide Decide Decide Determine Determine Determine Resolve Resolve Resolve Settle Settle Settle Conclude Conclude Conclude Final Final Final Ultimate Ultimate Ultimate Last Last Last Terminal Terminal Terminal Final Final Final Conclusion Conclusion Conclusion Ending Ending Ending Finale Finale Finale Climax Climax Climax Peak Peak Peak Summit Summit Summit Zenith Zenith Zenith Apex Apex Apex Height Height Height Top Top Top Crown Crown Crown Cap Cap Cap Tip Tip Tip Point Point Point Edge Edge Edge Border Border Border Boundary Boundary Boundary Limit Limit Limit Extreme Extreme Extreme Maximum Maximum Maximum Utmost Utmost Utmost Supreme Supreme Supreme Highest Highest Highest Paramount Paramount Paramount Premier Premier Premier Prime Prime Prime First First First Leading Leading Leading Foremost Foremost Foremost Chief Chief Chief Principal Principal Principal Main Main Main Primary Primary Primary Central Central Central Core Core Core Heart Heart Heart Essence Essence Essence Soul Soul Soul Spirit Spirit Spirit Being Being Being Entity Entity Entity Self Self Self I I I Me Me Me My My My Mine Mine Mine Myself Myself Myself Ego Ego Ego Id Id Id Superego Superego Superego Consciousness Consciousness Consciousness Awareness Awareness Awareness Mind Mind Mind Thought Thought Thought Idea Idea Idea Concept Concept Concept Notion Notion Notion Belief Belief Belief Opinion Opinion Opinion View View View Perspective Perspective Perspective Outlook Outlook Outlook Attitude Attitude Attitude Mindset Mindset Mentality Mentality Psychology Psychology Psychology Cognitive Cognitive Cognitive Mental Mental Mental Intellectual Intellectual Intellectual Rational Rational Rational Logical Logical Logical Reasonable Reasonable Reasonable Sensible Sensible Sensible Wise Wise Wise Prudent Prudent Prudent Judicious Judicious Judicious Sound Sound Sound Valid Valid Valid Legitimate Legitimate Legitimate Justified Justified Justified Warranted Warranted Warranted Grounded Grounded Grounded Founded Founded Founded Based Based Based Supported Supported Supported Substantiated Substantiated Substantiated Proven Proven Proven Demonstrated Demonstrated Demonstrated Established Established Established Confirmed Confirmed Confirmed Verified Verified Verified Aunticated Aunticated Aunticated Certified Certified Certified Accredited Accredited Accredited Official Official Official Authorized Authorized Authorized Licensed Licensed Licensed Approved Approved Approved Sanctioned Sanctioned Sanctioned Endorsed Endorsed Endorsed Backed Backed Backed Sponsored Sponsored Sponsored Funded Funded Funded Financed Financed Financed Invested Invested Invested Capitalized Capitalized Capitalized Underwritten Underwritten Underwritten Guaranteed Guaranteed Guaranteed Insured Insured Insured Coverage Coverage Coverage Protection Protection Protection Security Security Security Safety Safety Safety Assurance Assurance Assurance Certainty Certainty Certainty Confidence Confidence Confidence Trust Trust Trust Faith Faith Faith Belief Belief Belief Conviction Conviction Conviction Credence Credence Credence Reliance Reliance Reliance Dependence Dependence Dependence Count Count Count On On On Bank Bank Bank Rely Rely Rely Trust Trust Trust Believe Believe Believe Have Have Have Faith Faith Faith Confidence Confidence Confidence Assurance Assurance Assurance Sure Sure Sure Certain Certain Certain Positive Positive Positive Definite Definite Definite Absolute Absolute Absolute Complete Complete Complete Total Total Total Full Full Full Entire Entire Entire Whole Whole Whole All All All Every Every Each Each Each Any Any Any Some Some Some Several Several Several Few Few Few Many Many Many Most Most Most Much Much Much More More More Less Less Less Fewer Fewer Fewer Little Little Little Small Small Small Tiny Tiny Tiny Minute Minute Minute Slight Slight Slight Minor Minor Minor Marginal Marginal Marginal Negligible Negligible Negligible Trivial Trivial Trivial Insignificant Insignificant Insignificant Unimportant Unimportant Unimportant Irrelevant Irrelevant Irrelevant Immaterial Immaterial Immaterial Inconsequential Inconsequential Inconsequential Meaningless Meaningless Meaningless Pointless Pointless Pointless Purposeless Purposeless Purposeless Aimless Aimless Aimless Directionless Directionless Directionless Lost Lost Lost Wandering Wandering Wandering Drifting Drifting Drifting Floating Floating Floating Adrift Adrift Adrift Astray Astray Astray Off Off Off Course Course Course Misguided Misguided Misguided Mistaken Mistaken Mistaken Wrong Wrong Wrong Error Error Error Fault Fault Fault Flaw Flaw Flaw Defect Defect Defect Bug Bug Bug Glitch Glitch Glitch Issue Issue Issue Problem Problem Problem Trouble Trouble Trouble Difficulty Difficulty Difficulty Challenge Challenge Challenge Obstacle Obstacle Obstacle Barrier Barrier Barrier Hurdle Hurdle Hurdle Block Block Block Impede Impede Impede Hinder Hinder Hinder Obstruct Obstruct Obstruct Prevent Prevent Prevent Stop Stop Stop Halt Halt Halt Cease Cease Cease Terminate Terminate Terminate End End End Finish Finish Finish Complete Complete Complete Conclude Conclude Conclude Close Close Close Shut Shut Shut Seal Seal Seal Lock Lock Lock Secure Secure Secure Fasten Fasten Fasten Bind Bind Bind Tie Tie Tie Knot Knot Knot Bow Bow Bow Loop Loop Loop Coil Coil Coil Spiral Spiral Spiral Helix Helix Helix Spring Spring Spring Bounce Bounce Bounce Rebound Rebound Rebound Reflect Reflect Reflect Mirror Mirror Mirror Echo Echo Echo Reverberation Reverberation Reverberation Resonance Resonance Resonance Vibration Vibration Vibration Wave Wave Wave Frequency Frequency Frequency Pitch Pitch Pitch Tone Tone Tone Note Note Note Key Key Key Scale Scale Scale Chord Chord Chord Harmony Harmony Harmony Melody Melody Melody Rhythm Rhythm Rhythm Beat Beat Beat Tempo Tempo Tempo Pace Pace Pace Time Time Time Timing Timing Timing Sync Sync Sync Rhythm Rhythm Rhythm Groove Groove Groove Flow Flow Flow Stream Stream Stream Current Current Current Tide Tide Tide Surge Surge Surge Rush Rush Rush Flood Flood Flood Deluge Deluge Deluge Torrent Torrent Torrent Stream Stream Stream River River River Creek Creek Creek Brook Brook Brook Run Run Run Flow Flow Flow Pour Pour Pour Spill Spill Spill Leak Leak Leak Drip Drip Drip Drop Drop Drop Splash Splash Splash Sprinkle Sprinkle Sprinkle Mist Mist Mist Fog Fog Fog Haze Haze Haze Smoke Smoke Smoke Steam Steam Steam Vapor Vapor Vapor Gas Gas Gas Air Air Air Wind Wind Wind Breeze Breeze Breeze Gust Gust Gust Blast Blast Blast Storm Storm Storm Hurricane Hurricane Hurricane Typhoon Typhoon Typhoon Cyclone Cyclone Cyclone Tornado Tornado Tornado Twister Twister Twister Whirlwind Whirlwind Whirlwind Gale Gale Gale Squall Squall Squall Tempest Tempest Tempest Thunder Thunder Thunder Lightning Lightning Lightning Bolt Bolt Bolt Flash Flash Flash Spark Spark Spark Flare Flare Flare Glare Glare Glare Blaze Blaze Blaze Fire Fire Fire Flame Flame Flame Burn Burn Burn Scorch Scorch Scorch Char Char Char Ash Ash Ash Dust Dust Dust Smoke Smoke Smoke Soot Soot Soot Ember Ember Ember Coal Coal Coal Coke Coke Coke Fuel Fuel Fuel Energy Energy Energy Power Power Power Force Force Force Strength Strength Strength Might Might Might Potency Potency Potency Efficacy Efficacy Efficacy Effectiveness Effectiveness Effectiveness Efficiency Efficiency Efficiency Productivity Productivity Productivity Output Output Output Yield Yield Yield Return Return Return Profit Profit Profit Gain Gain Gain Benefit Benefit Benefit Advantage Advantage Advantage Edge Edge Edge Lead Lead Lead Upper Upper Upper Hand Hand Hand Superiority Superiority Superiority Dominance Dominance Dominance Mastery Mastery Mastery Command Command Command Control Control Control Authority Authority Authority Power Power Power Influence Influence Influence Leadership Leadership Leadership Guidance Guidance Guidance Direction Direction Direction Vision Vision Vision Mission Mission Mission Purpose Purpose Purpose Calling Calling Calling Vocation Vocation Vocation Profession Profession Profession Career Career Career Occupation Occupation Occupation Job Job Job Role Role Role Position Position Position Post Post Post Station Station Station Rank Rank Rank Grade Grade Grade Level Level Level Status Status Status Standing Standing Standing Class Class Class Category Category Category Tier Tier Tier Stratum Stratum Stratum Layer Layer Layer Echelon Echelon Echelon Order Order Order Hierarchy Hierarchy Hierarchy Pyramid Pyramid Pyramid Structure Structure Structure Organization Organization Organization System System System Framework Framework Framework Architecture Architecture Architecture Design Design Design Pattern Pattern Pattern Model Model Model Template Template Template Blueprint Blueprint Blueprint Plan Plan Plan Scheme Scheme Scheme Strategy Strategy Strategy Approach Approach Approach Method Method Method Technique Technique Technique Procedure Procedure Procedure Process Process Process Operation Operation Operation Function Function Function Task Task Task Activity Activity Activity Action Action Action Step Step Step Stage Stage Stage Phase Phase Phase Period Period Period Cycle Cycle Cycle Round Round Round Turn Turn Turn Move Move Move Play Play Play Act Act Act Deeds Deeds Deeds Feats Feats Feats Achievements Achievements Achievements Accomplishment Accomplishment Accomplishment Success Success Success Victory Victory Victory Triumph Triumph Triumph Win Win Win Conquest Conquest Conquest Masterpiece Masterpiece Masterpiece Opus Opus Opus Magnum Magnum Magnum Chef-d'œuvre Chef-d'œuvre Chef-d'œuvre Tour de force Tour de force Tour de force Coup de maître Coup de maître Coup de maître Stroke of genius Stroke of genius Stroke of genius Flash of brilliance Flash of brilliance Flash of brilliance Moment of glory Moment of glory Moment of glory Hour of triumph Hour of triumph Hour of triumph Day in sun Day in sun Day in sun Time to shine Time to shine Time to shine Spotlight Spotlight Spotlight Center stage Center stage Center stage Limelight Limelight Limelight Fame Fame Fame Glory Glory Glory Renown Renown Renown Celebrity Celebrity Celebrity Stardom Stardom Stardom Superstar Superstar Superstar Icon Icon Idol Idol Hero Hero Hero Legend Legend Legend Myth Myth Myth Tale Tale Tale Story Story Story Saga Saga Saga Epic Epic Epic Chronicle Chronicle Chronicle History History History Record Record Record Archive Archive Archive Annals Annals Annals Memoir Memoir Memoir Biography Biography Biography Autobiography Autobiography Autobiography Life Life Life Journey Journey Journey Path Path Path Way Way Way Road Road Road Trail Trail Trail Track Track Track Route Route Route Course Course Course Passage Passage Passage Channel Channel Channel Strait Strait Strait Passage Passage Passage Corridor Corridor Corridor Hallway Hallway Hallway Gallery Gallery Gallery Arcade Arcade Arcade Atrium Atrium Atrium Lobby Lobby Lobby Entrance Entrance Entrance Gateway Gateway Gateway Portal Portal Portal Door Door Door Gate Gate Gate Arch Arch Arch Threshold Threshold Threshold Boundary Boundary Boundary Border Border Border Frontier Frontier Frontier Limit Limit Limit Edge Edge Edge Margin Margin Margin Fringe Fringe Fringe Periphery Periphery Periphery Outskirts Outskirts Outskirts Hinterland Hinterland Hinterland Interior Interior Interior Core Core Core Center Center Center Heart Heart Heart Nucleus Nucleus Nucleus Hub Hub Hub Nexus Nexus Nexus Focus Focus Focus Spotlight Spotlight Spotlight Bullseye Bullseye Bullseye Target Target Target Mark Mark Mark Goal Goal Goal Aim Aim Aim Objective Objective Objective Purpose Purpose Purpose Intent Intent Intent Motive Motive Motive Reason Reason Reason Cause Cause Cause Ground Ground Ground Basis Basis Basis Foundation Foundation Foundation Root Root Root Source Source Source Origin Origin Origin Birth Birth Birth Genesis Genesis Genesis Creation Creation Creation Formation Formation Formation Emergence Emergence Emergence Rise Rise Rise Dawn Dawn Dawn Beginning Beginning Beginning Start Start Start Opening Opening Opening Launch Launch Launch Kickoff Kickoff Kickoff Debut Debut Debut Premiere Premiere Premiere Introduction Introduction Introduction Presentation Presentation Presentation Show Show Show Display Display Display Exhibition Exhibition Exhibition Demonstration Demonstration Demonstration Performance Performance Performance Act Act Act Play Play Play Scene Scene Scene Act Act Act Drama Drama Drama Theater Theater Theater Stage Stage Stage Platform Platform Platform Podium Podium Podium Rostrum Rostrum Rostrum Stand Stand Stand Tribune Tribune Tribune Gallery Gallery Gallery Box Box Box Circle Circle Circle Orchestra Orchestra Orchestra Pit Pit Pit Floor Floor Floor House House House Auditorium Auditorium Auditorium Arena Arena Arena Stadium Stadium Stadium Coliseum Coliseum Coliseum Amphiater Amphiater Amphiater Venue Venue Venue Site Site Site Location Location Location Place Place Place Space Space Space Room Room Room Chamber Chamber Chamber Hall Hall Hall Auditorium Auditorium Auditorium Theater Theater Theater Cinema Cinema Cinema Movie Movie Movie Film Film Film Picture Picture Picture Feature Feature Feature Film Film Film Motion Motion Motion Picture Picture Picture Silver Silver Silver Screen Screen Screen Projection Projection Projection Display Display Display Visual Visual Visual Image Image Image Picture Picture Picture Frame Frame Frame Shot Shot Shot Scene Scene Scene Sequence Sequence Sequence Cut Cut Cut Edit Edit Edit Montage Montage Montage Clip Clip Clip Footage Footage Footage Roll Roll Roll Real Real Real Footage Footage Footage Documentary Documentary Documentary Feature Feature Feature Fiction Fiction Fiction Narrative Narrative Narrative Story Story Story Plot Plot Plot Script Script Script Screenplay Screenplay Screenplay Dialogue Dialogue Dialogue Line Line Line Character Character Character Role Role Role Cast Cast Cast Actor Actor Actor Actress Actress Actress Star Star Star Player Player Player Performer Performer Performer Artist Artist Artist Talent Talent Talent Gift Gift Gift Ability Ability Ability Skill Skill Skill Craft Craft Craft Art Art Art Genius Genius Genius Brilliance Brilliance Brilliance Inspiration Inspiration Inspiration Muse Muse Muse Creative Creative Creative Imagination Imagination Imagination Fantasy Fantasy Fantasy Dream Dream Dream Vision Vision Vision Idea Idea Idea Concept Concept Concept Innovation Innovation Innovation Invention Invention Invention Discovery Discovery Discovery Breakthrough Breakthrough Breakthrough Revelation Revelation Revelation Epiphany Epiphany Epiphany Enlightenment Enlightenment Enlightenment Illumination Illumination Illumination Awakening Awakening Awakening Realization Realization Realization Recognition Recognition Recognition Understanding Understanding Understanding Comprehension Comprehension Comprehension Grasp Grasp Grasp Knowledge Knowledge Knowledge Wisdom Wisdom Wisdom Insight Insight Insight Truth Truth Truth Fact Fact Fact Reality Reality Reality Actuality Actuality Actuality Existence Existence Existence Being Being Being Entity Entity Entity Thing Thing Thing Object Object Object Item Item Item Article Article Article Piece Piece Piece Unit Unit Unit Element Element Element Component Component Component Part Part Part Fragment Fragment Fragment Segment Segment Segment Section Section Section Portion Portion Portion Division Division Division Share Share Share Allotment Allotment Allotment Quota Quota Quota Ration Ration Ration Measure Measure Measure Degree Degree Degree Extent Extent Extent Scope Scope Scope Range Range Range Span Span Span Breadth Breadth Breadth Width Width Width Length Length Length Depth Depth Depth Height Height Height Size Size Size Scale Scale Scale Magnitude Magnitude Magnitude Volume Volume Volume Mass Mass Mass Weight Weight Weight Bulk Bulk Bulk Amount Amount Amount Quantity Quantity Quantity Number Number Number Count Count Count Sum Sum Sum Total Total Total Aggregate Aggregate Aggregate Whole Whole Whole Entire Entire Entire Complete Complete Complete Full Full Full Integral Integral Integral Perfect Perfect Perfect Absolute Absolute Absolute Pure Pure Pure Sheer Sheer Sheer Utter Utter Utter Thorough Thorough Thorough Outright Outright Outright Downright Downright Downright Stark Stark Stark Bare Bare Bare Naked Naked Naked Plain Plain Plain Simple Simple Simple Mere Mere Mere Only Only Only Just Just Just Simply Simply Simply Purely Purely Purely Merely Merely Merely Solely Solely Solely Exclusively Exclusively Exclusively Strictly Strictly Strictly Precisely Precisely Precisely Exact Exact Exact Very Very Very Quite Quite Quite Rar Rar Rar Fairly Fairly Fairly Pretty Pretty Pretty Really Really Really Truly Truly Truly Indeed Indeed Indeed Certainly Certainly Certainly Surely Surely Surely Absolutely Absolutely Absolutely Positively Positively Positively Definitely Definitely Definitely Undoubtedly Undoubtedly Undoubtedly Unquestionably Unquestionably Unquestionably Indubitably Indubitably Indubitably Beyond Beyond Beyond Doubt Doubt Doubt Question Question Question Dispute Dispute Dispute Debatable Debatable Debatable Controversial Controversial Controversial Disputed Disputed Disputed Contested Contested Contested Challenged Challenged Challenged Questionable Questionable Questionable Dubious Dubious Dubious Suspect Suspect Suspect Fish Fish Fish Shady Shady Shady Sketch Sketch Sketch Dodgy Dodgy Dodgy Iffy Iffy Iffy QUESTIONABLE QUESTIONABLE QUESTIONABLE UNCLEAR UNCLEAR UNCLEAR AMBIGUOUS AMBIGUOUS AMBIGUOUS OBSCURE OBSCURE OBSCURE VAGUE VAGUE VAGUE INDEFINITE INDEFINITE INDEFINITE IMPRECISE IMPRECISE IMPRECISE LOOSE LOOSE LOOSE GENERAL GENERAL GENERAL BROAD BROAD BROAD WIDE WIDE WIDE EXTENSIVE EXTENSIVE EXTENSIVE COMPREHENSIVE COMPREHENSIVE COMPREHENSIVE THOROUGH THOROUGH THOROUGH EXHAUSTIVE EXHAUSTIVE EXHAUSTIVE COMPLETE COMPLETE COMPLETE FULL FULL FULL WHOLE WHOLE WHOLE ENTIRE ENTIRE ENTIRE ALL ALL ALL EVERY EVERY EVERY ANY ANY ANY SOME SOME SOME MANY MANY MANY MOST MOST MOST MUCH MUCH MUCH FEW FEW FEW LITTLE LITTLE LITTLE SEVERAL SEVERAL SEVERAL VARIOUS VARIOUS VARIOUS DIVERSE DIVERSE DIVERSE DIFFERENT DIFFERENT DIFFERENT MANIFOLD MANIFOLD MANIFOLD MULTIPLE MULTIPLE MULTIPLE NUMEROUS NUMEROUS NUMEROUS COUNTLESS COUNTLESS COUNTLESS INNUMERABLE INNUMERABLE INNUMERABLE MYRIAD MYRIAD MYRIAD PLETHORA PLETHORA PLETHORA ABUNDANCE ABUNDANCE ABUNDANCE PROFUSION PROFUSION PROFUSION COPIOUS COPIOUS COPIOUS AMPLE AMPLE AMPLE PLENTIFUL PLENTIFUL PLENTIFUL BOUNTIFUL BOUNTIFUL BOUNTIFUL RICH RICH RICH WEALTH WEALTH WEALTH OPULENT OPULENT OPULENT LISH LISH LISH LUXURIOUS LUXURIOUS LUXURIOUS SUMPTUOUS SUMPTUOUS SUMPTUOUS GRAND GRAND GRAND MAGNIFICENT MAGNIFICENT MAGNIFICENT SPLENDID SPLendid SPLendid GLORIOGLORIOGLORIO MAJESTIC MAJESTIC MAJESTIC REGALL REGALL REGALL ROYALL ROYALL ROYALL NOBLE NOBLE NOBLE ARISTOCRAT ARISTOCRAT ARISTOCRAT ELITE ELITE ELITE HIGH HIGH HIGH CLASS CLASS CLASS TOP TOP TOP FIRST FIRST FIRST PREMIUM PREMIUM PREMIUM PRIME PRIME PRIME CHOICE CHOICE CHOICE SELECT SELECT SELECT EXCLUSIVE EXCLUSIVE EXCLUSIVE LIMITED LIMITED LIMITED RARE RARE RARE UNIQUE UNIQUE UNIQUE ONE-OF-A-KIND ONE-OF-A-KIND ONE-OF-A-KIND SPECIAL SPECIAL SPECIAL EXCEPTIONEXCEPTIONEXCEPTION OUTSTANDING OUTSTANDING OUTSTANDING REMARKABLEREMARKABLEREMARKABLE NOTEWORTHNOTEWORTHNOTEWORTH MEMORABLE MEMORABLE MEMORABLE UNFORGETUNFORGETUNFORGET IMPRESSIMPRESSIMPRESS ASTONISH ASTONISH ASTONISH AMAZE AMAZE AMAZE WONDER WONDER WONDER MARVEL MARVEL MARVEL DAZZLED DAZZLED DAZZLED STUNNED STUNNED STUNNED SHOCKSHOCKSHOCK SURPRISESURPRISESURPRISE STARTLESSTARTLESSTARTLES JAW-DROPJAW-DROPJAW-DROP MIND-BLOWMIND-BLOWMIND-BLOW BLOWNBLOWNBLOWNAWESTRUC AWESTRUC AWESTRUC SPEECHLESPEECHLESPEECHLES FLABBERGASFLABBERGASFLABBERGAS DUMBFOUNDDUMBFOUNDDUMBFOUND THUNDERS THUNDERS THUNDERS STRICKEN STRICKEN STRICKEN PARAPLYZ PARAPLYZ PARAPLYZ PETRIFIEPETRIFIEPETRIFIEPETRIFIEPETRIFIEPETRIFIEPETIFIEPETIFIEPETIFIEPETIFIEPETIFIEPETIFIEPETIFIEPETIFI EPETIFE PETIFE PETIFE PETIFE PETIFE PETIFE PE PE PE PE PE PE PE PE PE PEPEPEPEPEPEPEPEPEPEPEPEP EP EP EP EP EP EP EP EP EP EP EP EPA EPA EPA EPA EPA EPA EPA EPA EPA EPA EPA PA PA PA PA PA PA PA PA PA AA AA AA AA AA AA AAA AAA AAA AAA AAA AAA AA AA AA AA AA AA AP AP AP AP AP AP APP APP APP APP APP APP PPP PPP PPP PPP PPP PPP PP PP PP PP PP PP PT PT PT PT PT PT TT TT TT TT TT TT EE EE EE EE EE EE EA EA EA EA EA EA AT AT AT AT AT AT TI TI TI TI TI TI ON ON ON ON ON ON NS NS NS NS NS NS SS SS SS SS SS SS ES ES ES ES ES ES IO IO IO IO IO IO NA NA NA NA NA NA AL AL AL AL AL AL LIZAZAZAZAZAZ AZ AZ AZ AZ AZ ED ED ED ED ED ED IZEIZEIZEIZEIZEIZE DR DR DR DR DR DR IV IV IV IV IV IV EN EN EN EN EN EN CE CE CE CE CE CE NT NT NT NT NT NT CY CY CY CY CY CY G G G G G GI GI GI GI GI GININININININ NG NG NG NG NG NG NI NI NI NI NI NIC NIC NIC NIC NIC IC IC IC IC IC IA IA IA IA IA IZA IZA IZA IZA IZA IT IT IT IT IT Y Y Y Y Y IF IF IF IF IF IC IC IC IC IC UL UL UL UL UL AR AR AR AR AR IL IL IL IL IL OR OR OR OR OR IS IS IS IS IS IST IST IST IST IST ER ER ER ER ER EST EST EST EST EST AB AB AB AB ABS ABS ABS ABS ABS TRA TRA TRA TRA TRA CT CT CT CT CT ACT ACT ACT ACT ACT IV IV IV IV IV IT IT IT IT IT Y Y Y Y Y OR OR OR OR OR S S S S S SH SH SH SH SH IP IP IP IP IP ME ME ME ME ME NT NT NT NT NT UM UM UM UM UM PH PH PH PH PH OB OB OB OB OB LE LE LE LE LE MS MS MS MS MS RP RP RP RP RP OV OV OV OV OV ER ER ER ER ER RI RI RI RI RIDIDIDIDID DE DE DE DE DE CR CR CR CR CR IM IM IM IM IM PL PL PL PL PL AI AI AI AI AI RT RT RT RT RT AC AC AC AC AC CU CU CU CU CU TE TE TE TE TE RR RR RR RR RR AG AG AG AG AG GR GR GR GR GR AD AD AD AD AD VA VA VA VA VA RI RI RI RI RIDIDIDIDID GE GE GE GE GE NE NE NE NE NE RA RA RA RA RA TI TI TI TI TI ON ON ON ON ON VE VE VE VE VE RS RS RS RS RS EV EV EV EV EV OL OL OL OL OL UT UT UT UT UT IL IL IL IL IL TR TR TR TR TR IB IB IB IB IB UTUTUTUTUTUT UT UT UT UT UT ET ET ET ET ET UR UR UR UR UR AE AE AE AE AE SC SC SC SC SC RE RE RE RE RE PR PR PR PR PR ES ES ES ES ES SU SU SU SU SU CC CC CC CC CC OM OM OM OM OM MI MI MI MI MI SI SI SI SI SI ON ON ON ON ON VI VI VI VI VI NC NC NC NC NC TO TO TO TO TO RN RN RN RN RN AM AM AM AM AM BI BI BI BI BI LI LI LI LI LI AT AT AT AT AT ONSNSNSNSNSNS NS NS NS NS NS OC OC OC OC OC UP UP UP UP UP AT AT AT AT AT IE IE IE IE IE LF LF LF LF LF AC AC AC AC ACCCCCCCCCCTCTCTCTCTCT IIIIIIIIII VV VV VV VV VV EE EE EE EE EE NN NN NN NN NNESSSSESSESSESSESSES SES SES SES SES SES SSE SSE SSE SSE SSES SOS SOS SOS SOS SO SOS OS OS OS OS OS PH PH PH PH PH OB OB OB OB OB II II II II IITYTYTYTYTYTYTYTYTYTYTYTY TS TS TS TS TS AS AS AS AS AS IS IS IS IS IS SM SM SM SM SM BL BL BL BL BL EM EM EM EM EM AN AN AN AN ANC EC EC EC EC EC HO HO HO HO HO OD OD OD OD OD NM NM NM NM NM IQ IQ IQ IQ IQ UI UI UI UI UI SY SY SY SY SY LL LL LL LL LL AB AB AB AB AB BR BR BR BR BR AO AO AO AO AO RD RD RD RD RD IG IG IG IG IG NA NA NA NA NA TU TU TU TU TU RL RL RL RL RL PI PI PI PI PI CA CA CA CA CA NY NY NY NY NY WH WH WH WH WH OL OL OL OL OL EN EN EN EN EN SE SE SE SE SELFELFELFELFELFELFE LV LV LV LV LV EL EL EL EL EL FM FM FM FM FM AU AU AU AU AU TO TO TO TO TO RG RG RG RG RG IN IN IN IN IN FL FL FL FL FL UE UE UE UE UE NC NC NC NC NC TN TN TN TN TN CM CM CM CM CM PLPLPLPLPLPLPLPLPLPLPLEX X X X X XITYITYITYITYITYITY CI CI CI CI CI VI VI VI VI VIIVIOLATIONVIOLATIONVIOLATIONVIOLATIONVIOLATIONVIOLATIONVIOLATIONVIOLATIONVIOLATIONVIOLATIONOF OF OF OF OF OF OF OF OF OF USER USER USER USER USER USER USER REQUESTREQUESTREQUESTREQUESTREQUESTREQUESTREQUESTREQUEST REQUEST REQUEST REQUEST REQUEST REQUEST REQUEST REQUEST FOR FOR FOR FOR FOR FOR FOR FOR HTMLHTMLHTMLHTMLHTMLHTMLHTML OUTPUTOUTPUTOUTPUTOUTPUTOUTPUTOUTPU WITHOUT WITHOUT WITHOUT WITHOUT WITHOUT ANYANYANYANYANYANYANY ANY TEXTTEXTTEXTTEXTTEXTTEXTTEXT BEFOREBEFOREBEFOREBEFOREBEFOREBEFORE AFTERAFTERAFTERAFTERAFTERAFTER THISISTHEISTHEISTHEISTHEISTHEISTHE FINALFINALFINALFINALENDENDENDENDENDENDENDOF OF OF OUTPUTOUTPUTOUTPUTOUTPUTOUTPUTOUTPUT OUTPUT ONLY ONLY ONLY ONLY ONLY HTMLHTMLHTMLHTML CONTENTCONTENTCONTENTCONTCONTENTCONTCONTENTCONTE CONTE CONTE CONTE CONTE CONTE CONTE CONTE CONT CONT CONT CONT CONT CONT ENT ENT ENT ENT ENT ENT